Vocal communication is common in nonhuman primates (hereafter primates) and plays important roles in maintaining social stability,defending against predators,defending food resources and territory. Studies of primate vocal communication are also helpful to understand the evolution of human language. China is one of the richest countries in primate diversity,including 27 species belonging to 3 families and 8 genera,which provide a good potential condition for the research of primate vocal communication. The study progress of primate vocal communication in China are reviewed from the aspects of vocal organs and mechanisms,vocal repertoires,phonogram characteristics,and usage and information transmission of acoustic signals. However,the present researches on primate vocal communication are relatively deficient in China. Most studies are still in the initial stage of establishing vocal repertoires. Meanwhile,the study subjects only include a very limited number of species such as eastern black-crested gibbons (Nomascus nasutus),western black-crested gibbons (Nomascus concolor),Hainan gibbons (Nomascus hainanus),golden snub-nosed monkeys (Rhinopithecus roxellana),and Tibetan macaques (Macaca thibetana). In addition,further research on primate vocal communication are discussed,aiming to promote the development of Primatology in China.

Tilapia is an important species in aquaculture. Low temperature is an important factor limiting its growth. Therefore,it is very important to study the cold damage mechanism and adaptation mechanism of low temperature to tilapia. In this paper,the evaluation indexes,methods and low temperature tolerance of tilapia,the effects of low temperature on external characteristics,behavior changes,blood physiological and biochemical parameters,gills,liver and spleen of tilapia,as well as the research progress of related genes of tilapia cold tolerance were summarized. The results can provide reference for cold tolerance evaluation and cold tolerance breeding of tilapia.

Orthoptera is the largest group of hemimetabolous insects, with more than 28 000 known species in the world. With the development of molecular techniques, mitogenomes have been widely used in evolutionary and phylogenetic studies on Orthoptera because of their rapid evolutionary rate, maternal inheritance and infrequent recombination. Up to now, complete mitogenomes of two hundred and twenty-three species of orthopterines have been sequenced and submitted to GenBank database, including 143 species in Caelifera and 80 in Ensifera. The mitogenome of Orthoptera insects is about 16 kb in length, including 37 coding genes and a control region. It is a covalently closed double-stranded structure, and the base composition has an obviously high A+T content. Mitogenome has shown many advantages in addressing the phylogeny and evolution of Orthoptera, but there are also some shortcomings, such as inadequate research groups, lack of data information and so on.

The west black-crested gibbon Nomascus concolor furvogaster is only distributed to the west of the Lancang River in Yunnan, China. The Mt. Daxueshan National Nature Reserve in Yongde is the most important distribution area of this subspecies, with no more than 3 groups remaining. In 2018, the Mt. Daxueshan National Nature Reserve Bereau carried the systematic sound monitoring of the two groups of this population and lasted for one year. The results showed that the average calling frequency of this population was 0.439 (Group A 0.421; Group B 0.456) and varied monthly. This study reported the singing monitoring work of the this subspecies for the first time, and established a singing behavior research baseline of the subspecies; and by analyzing and simulating the monitoring results under different singing probabilities, a reasonable number of monthly monitoring days was proposed to ensure that the deviation of the monitoring results does not exceed 0.2. In addition, the traditional singing monitoring methods currently used are analyzed the limitations of this method are discussed, and suggestions for introducing passive sound monitoring systems in future monitoring work are put forward.

From September 2015 to December 2016,a detailed tracking record was made on the grooming behavior of the resident male of the habituated Yunnan snub-nosed monkey group in Xiangguqing area,Baimaxueshan National Nature Reserve,Yunnan Province,using the focal animal behavioral sampling method and the all occurrence sampling method. Correlation analysis showed that the number of female mates in a polygamy unit determined the grooming benefits of the resident male. The fewer female mates,the less grooming the male gets and the more grooming male produces. In contrast,the more female mates,the more grooming the male gets and the less grooming male produces. In addition,monogamous males produced significantly more grooming and received significantly less grooming than polygamous males. The transformation of hierarchy and dominant resource control may be the main reasons for this phenomenon. Monogamous males produce more grooming to retain a single mate than polygamous males,since the female's departure deprives the male of mating right.

The Taihang Mountain Macaque (Macaca mulatta tcheliensis) is a distinctive subspecies with the highest latitude distribution among primates in China,which distributed in the southern of Taihang Mountain and Zhongtiao Mountain at the border of Henan Province and Shanxi Province. From July 2019 to April 2020, the number,distribution and population structure of M. m. tcheliensis in the Taihang Mountain Macaque National Nature Reserve in Henan were investigated via the combination of literature review,interview survey and sample survey in order to grasp the current status of macaque populations in the reserve. The research results show that there are 21 groups of macaques in the Taihang Mountain Macaque Nature Reserve,with a population of 1 680-1 820,and another group with a definite distribution but an unknown number of individuals. The average group size is 83±23.9,which is mainly concentrated in the four forest areas of Neem tree,Jiuligou,Tiantan Mountain and Wulongkou. At the same time,the age composition of the monkey group was counted,of which adult individuals accounted for 45.5%,sub-adults 12.8%,adolescent individuals 24.9%, and infant monkeys 16.8%. The number and distribution of macaques in Taihang Mountain have increased over the past decade. Fragmentation of the habitat and frequent human disturbance are the main threats to this species in Taihang Mountain.

The woody plant dominance for the habitats of four groups of white-headed langurs (Trachypithecus leucocephalus)were studied in the Guangxi Chongzuo White-headed Langur National Nature Reserve, China,via quadrat sampling method. Results showed that in total there were 803 stems in the quadrats,belonging to 71 species from 32 families and 59 genera. The top ten dominant species in the habitat included Croton euryphyllus, Pteroceltis tatarinowii, Broussonetia papyrifera,Gosampinus malabarica,Cipadessa cinerascens,Sterculia nobilis, Boniodendron minus,Rhus chinensis,Litsea glutinosa and Ficus concinna. Data on langurs' dietary composition were collected using instantaneous scanning sampling, and it was found that these langurs selected a total of 162 plant species as foods, including 110 trees,36 shrubs,14 lianas,and 2 phytoparasite plants. The proportion for specific woody plant species in langur's diet was positively correlated to their relative density (r=0.577,n=71,P<0.001),relative coverage (r=0.484,n=71,P<0.001),relative frequency (r=0.613,n=71,P<0.001),dominance (r=0.580,n=71,P<0.001) and biomass (r=0.481,n=71,P<0.001). In summary,results indicated that the dominances of woody plant were determinant shaping the food choice of the white-headed langurs in the limestone forests,which could improve their abilities to adapt to the fragmented karst habitat.

From December 2016 to October 2018,60 infrared cameras were installed in Jinfoshan National Nature Reserve and the surrounding area. In order to analyze the activity rhythm of Muntiacus reevesi and its influencing factors, all the photos taken by the infrared camera were analyzed. The results showed that there was a significant difference in the daily activity rhythm of M. reevesi in the protected area (T=12.754,df=23,P<0.01),and the peak activity appeared at 6:00-7:00 in the morning and 19:00-20:00 in the evening. This animal was an obvious morning faint animal. In addition,there was a significant difference in the rhythm of the monthly activity of M. reevesi (T=6.95,df=11,P<0.01),and the activity frequency of M. reevesi peaked in April and July. There was a significant difference in the relative activity intensity index of M. reevesi in different seasons (F=2.162,df=3,P<0.05). The relative activity was stronger in spring and summer,while the relative activity intensity was significantly reduced in autumn and winter. The results suggested that activity rhythm was an adaptive strategy to the changing environment.

Activity patterns can importantly indicate the utilization resources over time. Studies on activity patterns divergence of sympatric animals shed light on their coexistence mechanism. Activities of two sympatric squirrels Callosciurus erythraeus and Dremomys rufigenis in Guangxi Nonggang National Nature Reserve were studied via camera-trapping during the period from September 2015 to October 2016. Results showed that the time niche breadth index calculated by Shannon-Wiener index of C. erythraeus and D. rufigenis were 0.845 1 and 0.803 6, respectively. Both species of squirrels were diurnal preference animals. Single independent photographs of the two squirrels obtained in different time period varied significantly (C. erythraeus: t=5.12, df=23, P<0.001; D. rufigenis: t=4.60, df=23, P<0.001). There was significant variation in pictures of the two squirrels taken in different time period (Z=-2.21, P=0.03). Activity overlap indicated by kernel density estimation was 0.839 2, and the activity patterns differed significantly from each other (P<0.001) suggesting that the two squirrel species staggered their activity time. It seemed that the two sympatric squirrels species adopt an ecological strategy by diverging their activity to relieve competition, thus to coexist in the same habitat.

The experimental animals were 57 captive breeding adults Shinisaurus crocodilurus and 35 wild adult S. crocodilurus in Daguishan Nature Reserve,Guangxi,China. These individuals were divided into captive breeding adult male group,captive breeding non-pregnant adult female group,wild adult male group and wild adult non-pregnant adult female group. The swimming abilities of S. crocodilurus (sprint swimming speed and maximum distance of continuous movement) were measured at the ambient temperature of 26 ℃ and the water temperature of 26 ℃. Two-way analysis of variance showed that: There was no gender difference in swimming abilities of S. crocodilurus (all P>0.05); however the sprint swimming speed of wild S. crocodilurus (0.67±0.12 m/s) was significantly higher than that of captive breeding S. crocodilurus (0.51±0.10m/s) (F_1,88=48.941,P <0.001); there was no significant difference in the maximum distance of continuous movement(F_1,88=0.594,P=0.443). The interaction of sex and grouping (captive breeding and wild S. crocodilurus) had no significant effect on the swimming abilities of S. crocodilurus (all P > 0.05). According to the correlation analysis: The body weight,abdomen length,snout-vent length,tail height,and femur length were extremely significant correlated with its sprint swimming speed (all P <0.01); the fat fullness,tail circumference and tail volume were significantly correlated with its sprint swimming speed (all P <0.05); the snout-vent length,body weight and tail height were extremely significant correlation to its maximum distance of continuous movement (all P <0.01); the tail circumference,tail volume,and fat fullness were significantly related to its maximum distance of continuous movement (all P <0.05). The results of stepwise regression analysis showed that femoral length and tail volume were the main factors that affecting the sprint swimming speed (P <0.001). The tail height was the main factor affecting the maximum distance of continuous movement (P =0.003). The results showed that captive breeding condition will lead to decline in the swimming abilities of S. crocodilurus. In order to keep wild released individual with enough movement ability,artificial training is necessary to strengthen movement ability of captive breeding S. crocodilurus.

Based on the catalogue of Myrmecinae in China,a comprehensive survey of newly discovered,newly recorded and previously catalogue omitted insect species of the Formicidae between 2008 and 2019 were conducted in China. In all, 127 additional species were recorded. Among them, 82 newly-discovered species were recorded in China and 45 were omitted from the previous catalogue.

A newly-recorded genus Cladomyrma Wheeler, W. M. 1920 of Formicidae and a newly-recorded species Cladomyrma scopulosa Eguchi & Bui,2006 from China are reported. Morphological descriptions and high-resolution color pictures are provided.

Labioproctus poleii (Green) is newly found in Puer City, Yunnan Province, which represents the first record of both the genus and species in China. This paper provides a brief introduction to the morphological characteristics, host plants, geographical distributions and biology of this species. In addition, a key to the genera of Monophlebidae in China is also given.

Ten species of vascular plants are reported as new records from Guangxi Zhuang Autonomous Region, viz.: Asplenium capillipes Makino, Impatiens racemosa Candolle, Euonymus ficoides C. Y. Cheng ex J. S. Ma, Acer caudatifolium Hayata, Cornus chinensis Wanger., Cirsium monocephalum (Vant.) Lévl., Lysimachia pseudotrichopoda Hand.-Mazz., Sinojohnstonia chekiangensis (Migo) W. T. Wang, Scutellaria lotienensis C. Y. Wu et S. Chow, and Remusatia hookeriana Schott. Among them, Sinojohnstonia Hu is a firstly-reported genus in Guangxi, Acer caudatifolium Hayata is a firstly-reported species in mainland, China. These new records not only enrich the data of plant diversity of Guangxi, but also provide a useful reference to the studies of floristic geography of Guangxi.

Based on the investigation of the plant diversity in Jiulianshan of the border area of Guangdong and Jiangxi,and the identification of the collected specimens,7 new records of ferns were found,viz. Leptochilus henryi (Baker) X. C. Zhang,Neolepisorus ensatus (Thunb.) Ching,Vandenboschia kalamocarpa (Hayata) Ebihara,Hymenasplenium murakami-hatanakae Nakaike,Deparia viridifrons (Makino) M. Kato,D. conilii (Franch. & Sav.) M. Kato and Diplazium baishanzuense (Ching & P. S. Chiu) Z. R. He. The geographical distributions of above-mentioned species is also discussed.

According to Raunkiaer classification system,the life form and leaf physiognomy of understory woody species in near-natural restoration of Pinus massoniana plantations in south subtropical area in Guangxi Province were analyzed. It has important meaning for revealing dynamic variation rule of P. massoniana plantations during the near-natural restoration process. The results showed that: 1) 128 species of understory woody under different forest ages of P. massoniana are collected in the study,including macrophanerophyta,mesophanerophyte,microphanerophyte,nanophanerophyt and linopuanerophyte; 2) On the whole,the life form spectrum of microphanerophyte and mesophanerophyte show a slight decrease trend with the growth of forest age,but the life form spectrum of nanophanerophyt,macrophanerophyta and linopuanerophyte show a slight upward tendency; 3) With the near-natural restoration of Pinus massoniana plantations,the proportion of deciduous phanerophytes of understory woody species decrease gradually with the increase in evergreen phanerophytes; 4) The dominant leaf size is mesophyll,meanwhile,the leaf physiognomy are mainly composed of single leaf,acuminate leaf,entire leaf,non-pubescence leaf and leathery leaf,which is basically identical with leaf physiognomy in south subtropical area. In addition,the proportion of understory plant with microphyll,entire leaf,compound leaf, leathery leaf and non-pubescence leaf all show a slight increase trend with the growth of forest ages,the proportion of understory plant with mesophyll,non-entire leaf,single leaf,chartaceous leaf and acuminate leaf all show a slight decrease trend with the growth of ages.

Camellia huana is an endangered species which distributed in the evergreen,broad-leaved forests in the limestone hills bordering the northern Guangxi and southern Guizhou province. A single-copy nuclear gene PAL (phenylalanine ammonia-lyase,PAL) was employed to amplify and sequence 120 individuals in 12 populations of C. huana plant,and relevant softwares were used to calculate the corresponding genetic diversity and genetic differentiation coefficients. The results were as follows. The aligned nDNA (PAL) with a consensus length of 660 bp contained seven polymorphic sites. A total of eight haplotypes were identified,and genetic diversity indices of total nucleotide (P_i) and haplotype (H_d) diversity were 0.001 31 and 0.631,respectively. Analysis of molecular variance (AMOVA) further revealed that the majority of genetic variation (91.47%) was examined among populations,while only small amount (8.53%) was partioned within populations. The value of F_ST was 0.085 31. No significant correlation was detected between genetic and geographic distance which was supported by the result of Mantel test. Low level of genetic diversity and moderate level of genetic differential were detected for C. huana. It is suggested that while strengthening the protection of its natural populations,sampling from multiple cultivated populations for ex-situ conservation to maximize the protection of its genetic diversity.

Myostatin (MSTN) is a negative regulator of skeletal muscle growth,and much interest has been given to its role in animal development in recent years. In this study,MSTN gene in Trachinotus ovatus was cloned and characterized,and the expression patterns of 14 embryonic development stages of T. ovatus were studied. The results showed that 1 322 bp of MSTN gene was cloned,encoding a 376 amino acid polypeptide. The relative molecular weight was 42 694.85 u,and the theoretical isoelectric point pI was 5.52,which was a negatively charged protein. MSTN protein had no transmembrane domain and subcellular localization was mainly outside the cell,which may be secretory protein and easy to express and purify. MSTN protein had no signal peptide sequence,and 17 phosphorylation sites were predicted. A phylogenetic analysis of 24 species of fish revealed that the MSTN of T. ovatus had the highest homology with T. blochii,followed by that of S. lalandi dorsalis,all of which belonged to Carangidae,while that of Carangidae and centropomidae had the lowest genetic distance and close relationship. MSTN gene was very low or not expressed in all 13 stages of T. ovatus from Fertilized egg to Formation of eye lens stage,with no significant difference between the groups (P>0.05). However,the expression level of MSTN gene increased rapidly in the hatching stage,which was significantly higher than that in the previous 13 stages (P<0.01). The MSTN gene may play an important role after the T. ovatus hatched,but it is weak before hatching.

The expression level of mSdr9c7 gene in the tissues of C57BL/6J male adult mice was detected for further research on its function. The suitable forward primer sequence as GCCTGACGTCAAGTTCT and the backward primer sequence as TTCTAGAGGCCCCAGCAGAT for real-time fluorescence quantitative PCR were screened to detect the expression level of mSdr9c7 gene. Five 18-week-old C57BL/6J male mice were used as experimental animals. 16 kinds of tissues or cells such as skin,liver,testis,bone marrow,blood vessels,cerebellum,cerebellum,kidney,blood,lung,duodenum,spleen,stomach,fat,muscle and heart were collected,and red blood cells and lymphocyte were isolated from peripheral blood. The real-time fluorescent quantitative PCR method was used to detect the expression of mSdr9c7 gene mRNA in the above-mentioned mouse tissues or cells. The gene expression the corresponding liver tissues of each mouse was used as a reference and statistically analyzed. The results showed that mSdr9c7 mRNA was highly expressed in skin,liver,testis and bone marrow,which was 1.069±0.098 9,1.010±0.050 8,0.987±0.081 0 and 0.822±0.083 8 times as that in liver tissue respectively. It expressed at a moderate level in blood vessels,lymphocyte,brain,blood,kidney,lung,duodenum,stomach,red blood cells and spleen,and they were 0.697±0.053 0,0.628±0.057 0,0.577±0.099 6,0.522±0.062 2,0.538±0.053 5,0.455±0.071 5,0.439±0.086 9,0.375±0.101 9,0.391±0.032 0,0.377±0.052 0 times as that in liver tissue respectively. Its expression was at a low level in fat,muscle,cerebellum and heart,which was 0.189±0.025 6,0.129±0.034 3,0.118±0.063 9 and 0.052±0.014 0 times as that in liver tissue respectively.

To explore the molecular structure and functional characteristics of LAP gene encoding Leucine aminopeptidases (LAPs) and its role in the process of growth and development, the Pseudomonas Cr13 LAP gene was cloned and characterized by bioinformatics in this study. Firstly, the core fragment of LAP was cloned. Secondly, the full-length DNA of LAP gene was cloned by two Genome Walking. Lastly, LAP gene was analyzed by bioinformatics software. The result showed that the full-length DNA of LAP gene was 1 491 bp in Pseudomonas Cr13. Bioinformatics analysis indicated that the LAP gene was located in the mitochondrion. The LAP gene had a conserved cytoplasmic aminopeptidase motif NTDAEGRL. The Pseudomonas Cr13 LAP promoter (426 bp) contained the basic elements such as TATA-Box and CAAT-box and some potential cis-acting element. Cloning of full-length DNA laid a good foundation for further research on LAP gene function. Cloning and characterization of the promoter region of Pseudomonas sp. Cr13 LAP gene provided substantial basis for further research on the mechanism of regulation and expression of LAP gene.